Stem-loop sequence cbn-lin-4-2

AccessionMI0024908 (change log)
DescriptionCaenorhabditis brenneri lin-4-2 stem-loop
Gene family MIPF0000303; lin-4
Stem-loop
   ---u   u    c    a      -    ac 
5'     ccc gaga cuca guguga gcgu  u
       ||| |||| |||| |||||| ||||  g
3'     ggg cucu gggu cacacu cgua  u
   ccau   u    c    c      u    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig639: 19743-19803 [+]
intergenic
Database links

Mature sequence cbn-lin-4

Accession MIMAT0029734
Sequence

1 - 

ucccugagaccucaaguguga

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1