Stem-loop sequence cbn-mir-237

AccessionMI0024909 (change log)
DescriptionCaenorhabditis brenneri miR-237 stem-loop
Stem-loop
   --       gaa     u       c  aaa 
5'   ucccuga   uacuc ggcagcu ga   g
     |||||||   ||||| ||||||| ||    
3'   aggggcu   augag ucgucga cu   u
   cc       acc     -       u  gua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig108: 325352-325412 [-]
intergenic
Database links

Mature sequence cbn-miR-237

Accession MIMAT0029735
Sequence

1 - 

ucccugagaauacucuggcagcu

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1