Stem-loop sequence cbn-mir-47

AccessionMI0024922 (change log)
DescriptionCaenorhabditis brenneri miR-47 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   --        -      g       uc  uuu 
5'   aagggagc uuucug ugacagu  ga   u
     |||||||| |||||| |||||||  ||    
3'   uucucucg ggaggu acuguca  cu   g
   ac        c      -       uu  caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig42: 326154-326215 [+]
intergenic
Database links

Mature sequence cbn-miR-47

Accession MIMAT0029744
Sequence

41 - 

ugucauggaggcgcucucuuca

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1