Stem-loop sequence cbn-mir-49

AccessionMI0024923 (change log)
DescriptionCaenorhabditis brenneri miR-49 stem-loop
Gene family MIPF0000237; mir-49
Stem-loop
   --c          u   ua     c  --   ca 
5'    gcgguuuuuu gug  gugcu cg  cac  u
      |||||||||| |||  ||||| ||  |||   
3'    cgucgaagag cac  cacga gc  gug  c
   aga          -   --     a  uu   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig9: 1284686-1284748 [-]
intergenic
Database links

Mature sequence cbn-miR-49

Accession MIMAT0029745
Sequence

42 - 

aagcaccacgagaagcugcaga

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1