Stem-loop sequence cbn-mir-83-1

AccessionMI0024924 (change log)
DescriptionCaenorhabditis brenneri miR-83-1 stem-loop
Gene family MIPF0000251; mir-83
Stem-loop
   --           u  a  a  u   -  --  - a 
5'   acugaguuuau ug gu cu aga cg  gc c u
     ||||||||||| || || || ||| ||  || |  
3'   ugacuuaaaua ac ca ga ucu gc  cg g u
   ua           u  -  c  -   a  aa  a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig235: 108667-108732 [+]
intergenic
Database links

Mature sequence cbn-miR-83

Accession MIMAT0029746
Sequence

45 - 

uagcaccauauaaauucaguau

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1