Stem-loop sequence cbn-mir-124-1

AccessionMI0024933 (change log)
DescriptionCaenorhabditis brenneri miR-124-1 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   --    a    uga   a       -   c  c 
5'   gcau cacc   gug cuuuagu gga au u
     |||| ||||   ||| ||||||| ||| || g
3'   cgua gugg   cac ggaauca ccu ug a
   ac    a    -cg   -       a   u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig161: 45966-46029 [-]
intergenic
Database links

Mature sequence cbn-miR-124

Accession MIMAT0029752
Sequence

44 - 

uaaggcacgcggugaaugcca

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1