Stem-loop sequence cbn-mir-228-2

AccessionMI0024936 (change log)
DescriptionCaenorhabditis brenneri miR-228-2 stem-loop
Gene family MIPF0000292; mir-228
Stem-loop
   -a    c         a   a   -a  cau 
5'   augg acugcauga uuc cgg  ug   u
     |||| ||||||||| ||| |||  ||    
3'   uacc uggcguacu agg gcc  ac   g
   ga    a         -   c   ag  agc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig67: 892128-892188 [-]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-228-2
cbn-mir-228-2Cbre_Contig67: 892128-892188 [-]
cbn-mir-790-2Cbre_Contig67: 887165-887226 [-]
Database links

Mature sequence cbn-miR-228

Accession MIMAT0029753
Sequence

1 - 

aauggcacugcaugaauucacgg

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1