Stem-loop sequence cbn-mir-232

AccessionMI0024938 (change log)
DescriptionCaenorhabditis brenneri miR-232 stem-loop
Gene family MIPF0000311; mir-232
Stem-loop
   --c        uc   -     u   -  gccca 
5'    ccguaguu  gau cauuu auc cu     a
      ||||||||  ||| ||||| ||| ||     c
3'    ggcgucaa  cua guaaa uag ga     u
   agu        uu   c     -   u  aaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig147: 174313-174378 [+]
intergenic
Database links

Mature sequence cbn-miR-232

Accession MIMAT0029755
Sequence

44 - 

uaaaugcaucuuaacugcgguga

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1