Stem-loop sequence cbn-mir-234-2

AccessionMI0024940 (change log)
DescriptionCaenorhabditis brenneri miR-234-2 stem-loop
Gene family MIPF0000315; mir-234
Stem-loop
   --c         u   u       ag     cau 
5'    gguauucuu ggu aauaaua  gaugg   c
      ||||||||| ||| |||||||  |||||   a
3'    ccauaagaa ucg uuauuau  uuacu   c
   uuc         c   -       -a     cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig659: 54271-54337 [-]
intergenic
Database links

Mature sequence cbn-miR-234

Accession MIMAT0029756
Sequence

47 - 

uuauugcucaagaauacccuu

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1