Stem-loop sequence cbn-mir-7640-2

AccessionMI0024950 (change log)
DescriptionCaenorhabditis brenneri miR-7640-2 stem-loop
Gene family MIPF0001783; mir-7640
Stem-loop
   --     a  c  gu         - -a uu 
5'   ugaac uc ug  gaccaaaca c  g  a
     ||||| || ||  ||||||||| |  |   
3'   acuug ag gc  cugguuugu g  c  a
   aa     c  a  ug         a gg ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig496: 73137-73196 [-]
intergenic
Database links

Mature sequence cbn-miR-7640

Accession MIMAT0029763
Sequence

39 - 

uuuggucgucgagacguucaaa

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1