Stem-loop sequence cbn-mir-255-1

AccessionMI0024956 (change log)
DescriptionCaenorhabditis brenneri miR-255-1 stem-loop
Gene family MIPF0000368; mir-255
Stem-loop
   --             g        -    a 
5'   guaagaaaucuuu ugguuuuc cguu u
     ||||||||||||| |||||||| ||||  
3'   cauuuuuuagaga gucaaaag gcag g
   ga             a        a    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig1878: 5099-5157 [+]
intergenic
Database links

Mature sequence cbn-miR-255

Accession MIMAT0029768
Sequence

38 - 

aaacugaagagauuuuuuacag

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1