Stem-loop sequence cbn-mir-259

AccessionMI0024958 (change log)
DescriptionCaenorhabditis brenneri miR-259 stem-loop
Stem-loop
   -        -u  u    u   c   ucacaa 
5'  uaaucuca  cc aauc ggu gca      a
    ||||||||  || |||| ||| |||       
3'  guuagggu  gg uuag cca cgu      a
   a        uc  u    -   u   ccauuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig65: 6483-6545 [+]
intergenic
Database links

Mature sequence cbn-miR-259

Accession MIMAT0029769
Sequence

1 - 

uaaucucauccuaaucuggucgca

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1