Stem-loop sequence cbn-mir-359

AccessionMI0024962 (change log)
DescriptionCaenorhabditis brenneri miR-359 stem-loop
Stem-loop
   --u       c  uc u    a     uacu 
5'    gucagag aa  c cagu acacg    c
      ||||||| ||  | |||| |||||    a
3'    cagucuu uu  g guca ugugu    u
   aag       c  uu -    c     uuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig0: 1354736-1354797 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-359
cbn-mir-359Cbre_Contig0: 1354736-1354797 [+]
cbn-mir-249Cbre_Contig0: 1355964-1356026 [-]
Database links

Mature sequence cbn-miR-359

Accession MIMAT0029772
Sequence

41 - 

ucacugguuuucuucugacgaa

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1