Stem-loop sequence cbn-mir-67

AccessionMI0024967 (change log)
DescriptionCaenorhabditis brenneri miR-67 stem-loop
Gene family MIPF0000293; mir-67
Stem-loop
   --a    a     -cu      u    caaacau 
5'    acuc uucug   gguugu augc       u
      |||| |||||   |||||| ||||       g
3'    ugag aagau   ccaaca uacg       a
   agg    a     ccu      c    aauuuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig14: 796086-796153 [-]
intergenic
Database links

Mature sequence cbn-miR-67

Accession MIMAT0029775
Sequence

45 - 

ucacaaccuccuagaaagagugga

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1