Stem-loop sequence cbn-mir-76

AccessionMI0024969 (change log)
DescriptionCaenorhabditis brenneri miR-76 stem-loop
Stem-loop
   --         -      u      -  ga 
5'   aggacuuca caauag cgaaua cc  u
     ||||||||| |||||| |||||| ||  a
3'   uucugaagu guuguu gcuuau gg  g
   aa         a      -      a  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig31: 237121-237178 [-]
intergenic
Database links

Mature sequence cbn-miR-76

Accession MIMAT0029777
Sequence

37 - 

uucguuguugaugaagucuuaa

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1