Stem-loop sequence cbn-mir-85

AccessionMI0024972 (change log)
DescriptionCaenorhabditis brenneri miR-85 stem-loop
Gene family MIPF0000249; mir-85
Stem-loop
   --c  a        -       a     guuau 
5'    cg cuuuucaa uauuuug aacca     u
      || |||||||| ||||||| |||||     c
3'    gc gaaaaguu augaaac uuggu     u
   cgu  c        u       a     aagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig90: 27640-27705 [+]
intergenic
Database links

Mature sequence cbn-miR-85

Accession MIMAT0029780
Sequence

43 - 

uacaaaguauuugaaaagccgugc

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1