Stem-loop sequence pmi-mir-10

AccessionMI0025089 (change log)
DescriptionPatiria miniata miR-10 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   uuuauug          uua   c  u    c          ua  uug 
5'        cugcucugca   acc ug agau cgaauuugug  ag   u
          ||||||||||   ||| || |||| ||||||||||  ||   a
3'        gacgagacgu   ugg ac ucua gcuugaacac  uc   a
   --aucaa          cca   c  -    a          ug  uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-10-5p

Accession MIMAT0032143
Sequence

20 - 

aacccuguagauccgaauuugu

 - 41

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).