Stem-loop sequence pmi-mir-31-2

AccessionMI0025094 (change log)
DescriptionPatiria miniata miR-31-2 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   --    c     a    ag    u          ------    c 
5'   agug cgaag ggca  augu ggcauagcug      uguc a
     |||| ||||| ||||  |||| ||||||||||      ||||  
3'   ucac guuuu ccgu  uaca ccgugucgac      acag a
   gu    u     a    ca    u          uuuuau    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-31-5p

Accession MIMAT0032147
Sequence

11 - 

aggcaagauguuggcauagcu

 - 31

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).