Stem-loop sequence pmi-mir-100

AccessionMI0025104 (change log)
DescriptionPatiria miniata miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention pmi-mir-100
(4 sentences)

Stem-loop
   --------------auacc  ug   c     -a   c  a   c          ---u  g 
5'                    uc  guc gccca  acc gu gau cgaacuugug    ug c
                      ||  ||| |||||  ||| || ||| ||||||||||    ||  
3'                    ag  cgg cgggu  ugg ca cua gcuuggacac    ac u
   accauccguccuacgcuca  gu   u     cc   a  c   a          uuau  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-100-5p

Accession MIMAT0032156
Sequence

19 - 

aacccguagauccgaacuugu

 - 39

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).