Stem-loop sequence pmi-mir-200

AccessionMI0025113 (change log)
DescriptionPatiria miniata miR-200 stem-loop
Gene family MIPF0000019; mir-8
Literature search

1 open access papers mention pmi-mir-200
(1 sentences)

Stem-loop
   -----------------g         -         c      cg g  g 
5'                   uggcaucau accggacag auuaga  u gc a
                     ||||||||| ||||||||| ||||||  | || u
3'                   auuguagua uggucuguc uaaucu  g cg c
   acguagagacuuguggua         a         a      cg g  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-200-5p

Accession MIMAT0032165
Sequence

5 - 

caucauaccggacagcauuaga

 - 26

Get sequence
Evidence not experimental

Mature sequence pmi-miR-200-3p

Accession MIMAT0032166
Sequence

46 - 

uaauacugucugguaaugaugu

 - 67

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).