Stem-loop sequence pmi-mir-219

AccessionMI0025115 (change log)
DescriptionPatiria miniata miR-219 stem-loop
Gene family MIPF0000044; mir-219
Literature search

1 open access papers mention pmi-mir-219
(1 sentences)

Stem-loop
   guguuc   ca    u     a     a      uucaau 
5'       gcc  ugau gucca acgca uucuug      u
         |||  |||| ||||| ||||| ||||||      g
3'       cgg  acua caggu ugugu aagaac      u
   ---agu   ug    -     a     c      uucaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-219-5p

Accession MIMAT0032168
Sequence

12 - 

ugauuguccaaacgcaauucuug

 - 34

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).