Stem-loop sequence pmi-mir-2001

AccessionMI0025122 (change log)
DescriptionPatiria miniata miR-2001 stem-loop
Literature search

1 open access papers mention pmi-mir-2001
(1 sentences)

Stem-loop
   auu    gu      ua     c    a  a       guuaua 
5'    guca  uucguu  uguga cguu ca ugggcau      u
      ||||  ||||||  ||||| |||| || |||||||       
3'    cagu  gggcaa  acacu gcaa gu gcccgua      c
   gac    ac      ca     u    c  c       aaaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-2001-5p

Accession MIMAT0032175
Sequence

17 - 

augugaccguuacaaugggcau

 - 38

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).