Stem-loop sequence pmi-mir-2007

AccessionMI0025127 (change log)
DescriptionPatiria miniata miR-2007 stem-loop
Literature search

1 open access papers mention pmi-mir-2007
(1 sentences)

Stem-loop
   cgccau    -   c g            c    u        ca    au 
5'       ggca gcg u cuguauuucagg ggua acugguaa  gcuu  a
         |||| ||| | |||||||||||| |||| ||||||||  ||||  u
3'       cugu cgc g gauauaagguuc ucau ugaccauu  ugag  g
   gcaauu    u   a g            u    -        --    ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-2007-5p

Accession MIMAT0032181
Sequence

20 - 

uauuucaggcgguauacugguaa

 - 42

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).