Stem-loop sequence pmi-mir-2008

AccessionMI0025128 (change log)
DescriptionPatiria miniata miR-2008 stem-loop
Gene family MIPF0000729; mir-2008
Literature search

1 open access papers mention pmi-mir-2008
(8 sentences)

Stem-loop
   --c  u        c      a   c  c        -ag  cug 
5'    ca cuuuuacc cguauu aca ug ggcugaug   gg   u
      || |||||||| |||||| ||| || ||||||||   ||    
3'    gu gggaaugg gcauaa ugu gc ccgacuac   cc   u
   aca  c        a      c   c  u        caa  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-2008-3p

Accession MIMAT0032182
Sequence

55 - 

ucagccucgcugucaauacga

 - 75

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).