Stem-loop sequence pmi-mir-2011

AccessionMI0025131 (change log)
DescriptionPatiria miniata miR-2011 stem-loop
Gene family MIPF0000739; mir-2011
Literature search

1 open access papers mention pmi-mir-2011
(1 sentences)

Stem-loop
   ua     -        ca       u        a    ugucagu 
5'   gacuu gugcggug  gucacua cacaccuu ggug       a
     ||||| ||||||||  ||||||| |||||||| ||||       u
3'   cugaa cgcgucac  uagugau guguggaa ccac       u
   -c     a        ag       u        -    uggaccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-2011-5p

Accession MIMAT0032185
Sequence

16 - 

cagucacuaucacaccuuagg

 - 36

Get sequence
Evidence not experimental

Mature sequence pmi-miR-2011-3p

Accession MIMAT0032186
Sequence

58 - 

ccaagguguguuagugaugaca

 - 79

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).