Stem-loop sequence lva-let-7

AccessionMI0025134 (change log)
DescriptionLytechinus variegatus let-7 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   -          uuacgu   g         a       -   -----   a 
5'  ugaauggucc      gag uaguagguu uauaguu uug     gag u
    ||||||||||      ||| ||||||||| ||||||| |||     ||| a
3'  acuuaccggg      uuc aucguccga auaucga agc     cuc c
   c          -uuccu   g         c       u   gguaa   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-let-7-5p

Accession MIMAT0032189
Sequence

16 - 

ugagguaguagguuauauaguu

 - 37

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).