Stem-loop sequence bta-mir-2285g-2

Accession

MI0025184 (change log)

Description

Bos taurus miR-2285g-2 stem-loop

Gene family

MIPF0000747; mir-2284

Literature search

11 open access papers mention bta-mir-2285g-2
(15 sentences)

Stem-loop

   u  a  -                ug c       auac 
5'  ug gu ggccgaaaaguuuguu  g uuuuucc    c
    || || ||||||||||||||||  | |||||||    a
3'  ac ca ccgguuuuucgaacaa  c aaaaggg    u
   g  c  a                gu c       auuc 

Deep sequencing

1953 reads, 9.46 reads per million, 74 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr10: 30621132-30621209 [+]
• Overlapping transcripts:

  antisense

  ENSBTAT00000016895 ; AQR-201; intron 5

Database links

• RNAcentral:URS000075E485_9913
• miRBase Tracker:MI0025184

Mature sequence bta-miR-2285g

• Accession: MIMAT0024582
• Sequence: 49 - aaaccugaacaagcuuuuugg - 69
• Deep sequencing: 5359 reads, 74 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:bta-miR-2285g

References

1. PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).