Stem-loop sequence bta-mir-6529b

AccessionMI0025191 (change log)
DescriptionBos taurus miR-6529b stem-loop
Literature search

1 open access papers mention bta-mir-6529b
(1 sentences)

Stem-loop 
         g  cg     aa      aaa    a   ---  u   uu 
5' gaaacc ug  cucuu  agaggu   aggc cag   gc uca  g
   |||||| ||  |||||  ||||||   |||| |||   || |||  a
3' uuuugg ac  gagaa  ucucua   uccg guc   cg agu  c
         -  aa     -c      guc    c   uca  c   ua
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 65675391-65675480 [+]
antisense
ENSBTAT00000065045 ; GSK3B-201; intron 1
Clustered miRNAs
< 10kb from bta-mir-6529b
bta-mir-6529bchr1: 65675391-65675480 [+]
bta-mir-6529achr1: 65675397-65675475 [-]
Database links

Mature sequence bta-miR-6529b

Accession MIMAT0029947
Sequence

55 -  

acucugcgccucugaucucu

 - 74

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).