Stem-loop sequence mtr-MIR2656e

AccessionMI0025209 (change log)
DescriptionMedicago truncatula miR2656e stem-loop
Gene family MIPF0000976; MIR2656
Stem-loop
   ---acau    a aaga    ua    -gc    u   -gu   ag     -        g c   g 
5'        gcau u    gguc  aguu   auaa cga   ugg  ucaca uuugucga u aag a
          |||| |    ||||  ||||   |||| |||   |||  ||||| |||||||| | |||  
3'        cgug a    uuag  ucaa   uauu guu   guu  agugu gaauaguu a uuu u
   aguaaau    a ---g    ua    aca    u   aau   ga     u        g a   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 12367058-12367184 [+]
intergenic
Database links

Mature sequence mtr-miR2656e

Accession MIMAT0029969
Sequence

20 - 

aaguugcauaaucgaguugg

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).