Stem-loop sequence mtr-MIR2659h

AccessionMI0025211 (change log)
DescriptionMedicago truncatula miR2659h stem-loop
Gene family MIPF0000830; MIR2659
Stem-loop
   a    a    aaaucaa   c    --       c    g     ucuucaucgaauauggauauagauacuccugcuuaugaaaucaaaggaagaacuauguc 
5'  uucu cuuc       ugg aucu  ucaaguu ugcc guggu                                                           u
    |||| ||||       ||| ||||  ||||||| |||| |||||                                                           a
3'  aaga gaag       auc uaga  gguucag gugg uacca                                                           u
   g    c    ----aac   u    au       c    g     cucaaucucuucacuuuagguguccuaaaaggcgaacuuacuaaucgaggguaaggagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 7668230-7668434 [+]
intergenic
Database links

Mature sequence mtr-miR2659h

Accession MIMAT0029971
Sequence

166 - 

ccaugggugcgacuugguaag

 - 186

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).