Stem-loop sequence mtr-MIR2667b

AccessionMI0025216 (change log)
DescriptionMedicago truncatula miR2667b stem-loop
Gene family MIPF0001746; MIR2667
Stem-loop
   g   -        a       -u   u 
5'  cgu ugguagcc ucagauc  gga c
    ||| |||||||| |||||||  |||  
3'  gua gccaucgg agucuag  ccu g
   a   u        c       uu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR2667b

Accession MIMAT0029976
Sequence

29 - 

uccuugaucugacggcuacc

 - 48

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).