Stem-loop sequence mtr-MIR319c

AccessionMI0025219 (change log)
DescriptionMedicago truncatula miR319c stem-loop
Gene family MIPF0001104; MIR319
Literature search

5 open access papers mention mtr-MIR319c
(16 sentences)

Stem-loop
   c    a            g   c       -------    a  g  a 
5'  agaa ugggaguuccuu cag ccaaagc       gcca gu ag a
    |||| |||||||||||| ||| |||||||       |||| || ||  
3'  ucuu acccucgaggga guc gguuuug       cggu ca uc u
   u    g            a   a       uauuaaa    -  -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
contig_50311: 658-746 [+]
intergenic
Database links

Mature sequence mtr-miR319c-5p

Accession MIMAT0029980
Sequence

9 - 

ggaguuccuugcagcccaaag

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR319c-3p

Accession MIMAT0029981
Sequence

63 - 

uuggacugaagggagcuccca

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).