Stem-loop sequence mtr-MIR319d

AccessionMI0025220 (change log)
DescriptionMedicago truncatula miR319d stem-loop
Gene family MIPF0000010; MIR159
Literature search

5 open access papers mention mtr-MIR319d
(16 sentences)

Stem-loop
   -agaa       uc   a                 cu  u        a    uuu    --      g   ac        u  aa       agaaga      a 
5'      aaauagu  aag gagcucucuucagucca  ca ggauagga aagg   ugaa  uuagcu cug  ucauucau ca  cacaaua      agcaug u
        |||||||  ||| |||||||||||||||||  || |||||||| ||||   ||||  |||||| |||  |||||||| ||  |||||||      |||||| g
3'      uuugucg  uuc cucgagggaagucaggu  gu ucuguucu uuuc   acuu  aaucga ggc  aguaagug gu  guguuau      ucguau a
   auaua       uu   c                 uc  u        c    --u    ua      g   gu        u  aa       -----a      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 19927077-19927283 [+]
intergenic
Database links

Mature sequence mtr-miR319d-5p

Accession MIMAT0029982
Sequence

17 - 

agagcucucuucaguccacuc

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR319d-3p

Accession MIMAT0029983
Sequence

172 - 

uuggacugaagggagcucccu

 - 192

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).