Stem-loop sequence mtr-MIR397

AccessionMI0025221 (change log)
DescriptionMedicago truncatula miR397 stem-loop
Gene family MIPF0000120; MIR397
Literature search

4 open access papers mention mtr-MIR397
(21 sentences)

Stem-loop
   u           c        c     u        cuuau   -   --ucuagc    u 
5'  uggagaaacau auugagug agcgu gaugaaau     gua gca        uauc u
    ||||||||||| |||||||| ||||| ||||||||     ||| |||        |||| a
3'  auuuuuuugua uaacucac ucgca cuacuuua     cgu cgu        auag u
   a           u        a     u        --auu   a   uauaaacu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
contig_103871: 626-745 [-]
intergenic
Database links

Mature sequence mtr-miR397-5p

Accession MIMAT0029984
Sequence

12 - 

ucauugagugcagcguugaug

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR397-3p

Accession MIMAT0029985
Sequence

91 - 

ucuacgcuacacucaauuaug

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).