Stem-loop sequence mtr-MIR7698

AccessionMI0025227 (change log)
DescriptionMedicago truncatula miR7698 stem-loop
Stem-loop
                   ca     uu                  u                         g 
5' uaauuugcugugauag  guucu  caguuuuucaucaaaguu ucuggauauaguagauagucuacua a
   ||||||||||||||||  |||||  |||||||||||||||||| ||||||||||||||||||||||||| a
3' auuaaacgacacuauc  cagga  gucgaaaaguaguuucaa agaccuauauugucuaucagauggu g
                   aa     gg                  c                         g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 10368446-10368588 [-]
intergenic
Database links

Mature sequence mtr-miR7698-5p

Accession MIMAT0029996
Sequence

30 - 

uuuucaucaaaguuuucugga

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR7698-3p

Accession MIMAT0029997
Sequence

96 - 

cagacaacuuugaugaaaagc

 - 116

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).