Stem-loop sequence mtr-MIR7699

AccessionMI0025228 (change log)
DescriptionMedicago truncatula miR7699 stem-loop
Stem-loop
         u   u                                              c   a 
5' aaaaga gaa cauuuaaugcauugauuacacaacuuugaaugcaaauauuaccuuu uug c
   |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| ||| u
3' uuuucu cuu guaaauuacguaacuaauguguugaaacuuacguuuauaaugggaa aau u
         c   c                                              u   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 21146007-21146133 [+]
intergenic
Database links

Mature sequence mtr-miR7699-5p

Accession MIMAT0029998
Sequence

13 - 

auuuaaugcauugauuacaca

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR7699-3p

Accession MIMAT0029999
Sequence

97 - 

uguaaucaaugcauuaaaugc

 - 117

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).