Stem-loop sequence mtr-MIR7700

AccessionMI0025229 (change log)
DescriptionMedicago truncatula miR7700 stem-loop
Stem-loop
   aggaaucagagcu                                                             g                                                                                                                                       c                                                                                                                                                                                                       -            cggauauuucggaauauagugacuccguugaugacuu 
5'              uuuagguucuuuuaauaaggaaaauauuuugaaugacccugucauuuuuaaacaaguggag guggggaaggcugugccccacgcgccugucuuggagguggagugugggacagcuugcaaguugcuggcaggggagcagcacgcgucccacgcgccaguuuuauuauggggccuguugcuuuuaaggcccauugcu ugggguggaucagcaguguuguuugggugauagggggugcagaaucaaucagaggaccuccuuucuucaaauauugggaguuuucaugaugaaggccugggaguggguucaaauguugaggaggggcuuauagcgcaugguuauucuguggugguggugguggggugggggguugcaacucaaccaacauauucgauuc uuucggaagagu                                     u
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||                                     g
3'              aaauccaagaaaauuauuccuuuuauaaaacuuacugggacaguaaaaauuuguucaccuc caccccuuccgacacggggugcgcggacagaaccuccaccucacacccugucgaacguucaacgaccguccccucgucgugcgcagggugcgcggucaaaauaauaccccggacaacgaaaauuccggguaacga accccaccuagucgucacaacaaacccacuaucccccacgucuuaguuagucuccuggaggaaagaaguuuauaacccucaaaaguacuacuuccggacccucacccaaguuuacaacuccuccccgaauaucgcguaccaauaagacaccaccaccaccaccccaccccccaacguugaguugguuguauaagcuaag aaagccuucuca                                     u
   ------------a                                                             a                                                                                                                                       u                                                                                                                                                                                                       g            uacuugguuaauccuauucuaaaagacgaguaggggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 26045881-26046790 [+]
intergenic
Database links

Mature sequence mtr-miR7700-5p

Accession MIMAT0030000
Sequence

112 - 

guggagugugggacagcuugc

 - 132

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).