Stem-loop sequence mtr-MIR169l

AccessionMI0025230 (change log)
DescriptionMedicago truncatula miR169l stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

12 open access papers mention mtr-MIR169l
(51 sentences)

Stem-loop
   gc       g     c         -u              c uua   aag   aa    aa   u 
5'   agagagu uagua agccaagga  gacuugccggccgg g   gug   gca  ggca  uga c
     ||||||| ||||| |||||||||  |||||||||||||| |   |||   |||  ||||  |||  
3'   ucuuuca guuau ucgguuccu  uugaacggccggcc c   uac   cgu  uugu  acu a
   cu       g     a         uu              u uua   gua   ac    --   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR169l-5p

Accession MIMAT0030001
Sequence

16 - 

cagccaaggaugacuugccgg

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR169l-3p

Accession MIMAT0030002
Sequence

99 - 

ggcaaguuuuuccuuggcuaua

 - 120

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).