Stem-loop sequence mtr-MIR7701

AccessionMI0025237 (change log)
DescriptionMedicago truncatula miR7701 stem-loop
Stem-loop
   u   c                           a                g    u             a     a  gcguguggaucacaaaacacauuagcuaccaguuaaaaguccugaugacucgugaaguuuauucaacccagaccaguuggcaugggauauaaau 
5'  ggu uauauuaugaaucacauacaucauuaa ugaaugaaucuaaaaa uaaa uuuauuuauauuu aaaac ga                                                                                              g
    ||| ||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||| ||||| ||                                                                                              a
3'  cca guauaauauuugguguauguaguaauu acuuacuuggauuuuu auuu aaaugaauauaaa uuuug cu                                                                                              g
   a   a                           a                g    u             a     c  aacucauauaugaucguacgguuaaauuucgaacuugguaaaauacaugauauaucgucaccgguaaugagggaacagccaagugggggagagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 10522328-10522672 [-]
intergenic
Database links

Mature sequence mtr-miR7701-5p

Accession MIMAT0030015
Sequence

28 - 

auuaaaugaaugaaucuaaaa

 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR7701-3p

Accession MIMAT0030016
Sequence

300 - 

uuagguucauucaauuaauga

 - 320

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).