Stem-loop sequence oar-let-7d

AccessionMI0025244 (change log)
DescriptionOvis aries let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

12 open access papers mention oar-let-7d
(37 sentences)

Stem-loop
          a              c      uuagggcagggauu 
5' ccuagga gagguaguagguug auaguu              u
   ||||||| |||||||||||||| ||||||               
3' ggauucu uuccgucguccagc uaucaa              u
          -              a      uggaggaacacccg 
Get sequence
Deep sequencing
20884 reads, 3.33e+03 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr2: 27327398-27327484 [-]
intergenic
Clustered miRNAs
< 10kb from oar-let-7d
oar-let-7achr2: 27329964-27330043 [-]
oar-let-7dchr2: 27327398-27327484 [-]
Database links

Mature sequence oar-let-7d

Accession MIMAT0030023
Sequence

8 - 

agagguaguagguugcauag

 - 27

Get sequence
Deep sequencing19775 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).