Stem-loop sequence oar-let-7g

AccessionMI0025246 (change log)
DescriptionOvis aries let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

13 open access papers mention oar-let-7g
(38 sentences)

Stem-loop
   a   u        a            ugagg    -a  a    a 
5'  ggc gagguagu guuuguacaguu     gucu  ug uacc c
    ||| |||||||| ||||||||||||     ||||  || ||||  
3'  ccg uuccguca cggacaugucaa     uaga  ac augg c
   -   -        c            -----    gg  -    c 
Get sequence
Deep sequencing
418235 reads, 9.54e+04 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr19: 48614058-48614140 [+]
sense
ENSOART00000006185 ; WDR82-201; intron 2
Database links

Mature sequence oar-let-7g

Accession MIMAT0030025
Sequence

5 - 

ugagguaguaguuuguacagu

 - 25

Get sequence
Deep sequencing417671 reads, 16 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).