Stem-loop sequence oar-let-7i

AccessionMI0025247 (change log)
DescriptionOvis aries let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

12 open access papers mention oar-let-7i
(52 sentences)

Stem-loop
   c    u                 u   --------  u     ugu 
5'  uggc gagguaguaguuugugc guu        gg cgggu   g
    |||| ||||||||||||||||| |||        || |||||   a
3'  aucg uuccgucaucgaacgcg caa        uc gcccg   c
   -    -                 u   uagaggug  -     uua 
Get sequence
Deep sequencing
148321 reads, 4.41e+04 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr3: 156661935-156662018 [-]
sense
ENSOART00000026382 ; oar-let-7i-201; exon 1
Database links

Mature sequence oar-let-7i

Accession MIMAT0030026
Sequence

6 - 

ugagguaguaguuugugcuguu

 - 27

Get sequence
Deep sequencing148117 reads, 15 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).