Stem-loop sequence oar-mir-17

Accession

MI0025258 (change log)

Description

Ovis aries miR-17 stem-loop

Gene family

MIPF0000001; mir-17

Literature search

3 open access papers mention oar-mir-17
(4 sentences)

Stem-loop

       ga       -ca        a  g     g   -  au 
5' guca  auaaugu   aagugcuu ca ugcag uag ug  u
   ||||  |||||||   |||||||| || ||||| ||| ||  u
3' cagu  uauuacg   uucacgga gu acguc auc ac  g
       gg       aug        a  g     -   u  gu 

Deep sequencing

60748 reads, 1.11e+04 reads per million, 13 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Oar_v4.0; GCA_000298735.2): chr10: 66141653-66141736 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from oar-mir-17

• oar-mir-17: chr10: 66141653-66141736 [+]
• oar-mir-19b: chr10: 66142232-66142318 [+]

Database links

• miRBase Tracker:MI0025258

Mature sequence oar-miR-17-5p

• Accession: MIMAT0030037
• Sequence: 14 - caaagugcuuacagugcaggua - 35
• Deep sequencing: 56594 reads, 13 experiments
• Evidence: experimental; cloned [1]

References

1. PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).