Stem-loop sequence oar-mir-27a

AccessionMI0025275 (change log)
DescriptionOvis aries miR-27a stem-loop
Gene family MIPF0000036; mir-27
Literature search

6 open access papers mention oar-mir-27a
(23 sentences)

Stem-loop
   uggccu    a  a         ug  u       g u cac 
5'       gggg gc gggcuuagc  cu gugagca g c   a
         |||| || |||||||||  || ||||||| | |    
3'       cccc cg cuugaaucg  ga cacuugu c g   u
   ------    -  c         gu  -       g u aac 
Get sequence
Deep sequencing
92533 reads, 1.54e+04 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr5: 9882298-9882375 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-27a
oar-mir-23achr5: 9882124-9882196 [+]
oar-mir-27achr5: 9882298-9882375 [+]
Database links

Mature sequence oar-miR-27a

Accession MIMAT0030053
Sequence

54 - 

uucacaguggcuaaguuccgc

 - 74

Get sequence
Deep sequencing92251 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).