Stem-loop sequence bdi-MIR397b

AccessionMI0025288 (change log)
DescriptionBrachypodium distachyon miR397b stem-loop
Gene family MIPF0000120; MIR397
Literature search

2 open access papers mention bdi-MIR397b
(11 sentences)

Stem-loop
   -        u      a      c     u       u     -c   -  c 
5'  gcagaggc ugauug gugcag guuga gaacccc cugcg  cca gg c
    |||||||| |||||| |||||| ||||| ||||||| |||||  ||| ||  
3'  cgucuccg acuaac cacguc cagcu cuugggg ggcgc  ggu cc g
   u        c      c      c     u       -     aa   a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bdi-miR397b-5p

Accession MIMAT0030065
Sequence

12 - 

auugagugcagcguugaugaa

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR397b-3p

Accession MIMAT0030066
Sequence

72 - 

cuucgacccugcacccaauca

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).