Stem-loop sequence bdi-MIR156e

AccessionMI0025290 (change log)
DescriptionBrachypodium distachyon miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

5 open access papers mention bdi-MIR156e
(25 sentences)

Stem-loop
   ---   a   a          -     -               gccuuucuugcauggugaaucagag 
5'    gag ugg ggcugacaga agaga gugagcacacauggu                         a
      ||| ||| |||||||||| ||||| |||||||||||||||                         g
3'    uuc auu ccgacugucu ucucu cacucguguguaucg                         a
   aca   -   a          c     u               aaguucguacuugcgagaaagaggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 4030451-4030583 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR156e
bdi-MIR156e2: 4030451-4030583 [+]
bdi-MIR156f2: 4030679-4030788 [+]
bdi-MIR156g2: 4030916-4031026 [+]
Database links

Mature sequence bdi-miR156e-5p

Accession MIMAT0030071
Sequence

12 - 

ugacagaagagagugagcac

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR156e-3p

Accession MIMAT0030072
Sequence

101 - 

gcucacuucucucucugucagc

 - 122

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).