Stem-loop sequence bdi-MIR395o

AccessionMI0025299 (change log)
DescriptionBrachypodium distachyon miR395o stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention bdi-MIR395o
(31 sentences)

Stem-loop
   --uau     u  a      a              ga    auu 
5'      uauca ga uucccu caagcacuucacaa  agcu   c
        ||||| || |||||| ||||||||||||||  ||||    
3'      guagu cu aagggg guuugugaaguguu  ucgg   c
   ccacu     u  c      -              -a    gau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 55440734-55440819 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR395o
bdi-MIR395o1: 55440734-55440819 [-]
bdi-MIR395b1: 55440558-55440678 [-]
bdi-MIR395m1: 55440156-55440250 [-]
Database links

Mature sequence bdi-miR395o-5p

Accession MIMAT0030093
Sequence

12 - 

auucccuacaagcacuucaca

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR395o-3p

Accession MIMAT0030094
Sequence

56 - 

ugaaguguuugggggaacuc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).