Stem-loop sequence bdi-MIR5167b

AccessionMI0025302 (change log)
DescriptionBrachypodium distachyon miR5167b stem-loop
Gene family MIPF0001714; MIR5167
Stem-loop
   -      c       a              -   a    -a   aaa            u     a c    accauggcgcgacagaaaagaacgacauuggc 
5'  gucauu gugcucu guuaagguaauuua acu gaag  uag   ucuagauuuuuu auguu c uucc                                a
    |||||| ||||||| |||||||||||||| ||| ||||  |||   |||||||||||| ||||| | ||||                                 
3'  caguaa cacgaga caauuccguuaagu uga cuuc  auc   agauuuaagaaa uauaa g aagg                                u
   a      c       g              g   g    cg   cuc            -     c a    accuucaauuaagggcuugcuguacacggagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 42129670-42129875 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR5167b
bdi-MIR5167b4: 42129670-42129875 [-]
bdi-MIR5167a4: 42126781-42127074 [-]
Database links

Mature sequence bdi-miR5167b-5p

Accession MIMAT0030099
Sequence

12 - 

ucuaguuaagguaauuuaacu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR5167b-3p

Accession MIMAT0030100
Sequence

175 - 

ugugaauugccuuaacgagagc

 - 196

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).