Stem-loop sequence bdi-MIR5174b

AccessionMI0025303 (change log)
DescriptionBrachypodium distachyon miR5174b stem-loop
Gene family MIPF0001200; MIR5067
Literature search

1 open access papers mention bdi-MIR5174b
(3 sentences)

Stem-loop
   auccac                     a         u         g 
5'       uacucccucuguuccauaaag uuggcgcgg uuugaacua c
         ||||||||||||||||||||| ||||||||| |||||||||  
3'       augagggaggcaagguauuuc aaccguguu aaacuugau c
   auauau                     c         u         c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 50778133-50778230 [-]
intergenic
Database links

Mature sequence bdi-miR5174b-5p

Accession MIMAT0030101
Sequence

12 - 

ccucuguuccauaaagauugg

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR5174b-3p

Accession MIMAT0030102
Sequence

68 - 

caaccuuuauggaacggaggg

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).