Stem-loop sequence bdi-MIR5185c

AccessionMI0025307 (change log)
DescriptionBrachypodium distachyon miR5185c stem-loop
Gene family MIPF0001246; MIR5185
Literature search

1 open access papers mention bdi-MIR5185c
(1 sentences)

Stem-loop
   auccc          c            u                     a   u 
5'      gcgaaagucc gcuucuaguuca uuuucaaaucuuuuauucaaa uuu g
        |||||||||| |||||||||||| ||||||||||||||||||||| ||| c
3'      cgcuuucagg cgaagaucaagu aagaguuuagagaauaaguuu aga u
   ---ga          a            u                     a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 47573609-47573718 [+]
intergenic
Database links

Mature sequence bdi-miR5185c-5p

Accession MIMAT0030109
Sequence

19 - 

uucuaguucauuuuucaaauc

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR5185c-3p

Accession MIMAT0030110
Sequence

77 - 

uuugagaauugaacuagaagc

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).